5490 - 15858 Homo sapiens - Deletions Deletion length: 10367 bp Removes OL Removing part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	5490 5fl vs 3del Homology length: 9 bp Deleted region 15858 GCTACTCCTACCTATCTCCC ├ 5'Breakpoint ┤ CTTTTATACTAATAATCTTA (...) CCTAATACCAACTATCTCCC ├ 3'Breakpoint ┤ TAATTGAAAACAAAATACTC 5del vs 3del Homology length: 1 bp GCTACTCCTACCTATCTCCC ├ 5'Breakpoint ┤ CTTTTATACTAATAATCTTA (...) CCTAATACCAACTATCTCCC ├ 3'Breakpoint ┤ TAATTGAAAACAAAATACTC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.